Review



sgrnas cas9n vector  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 96
      Buy from Supplier

    Structured Review

    Addgene inc sgrnas cas9n vector
    Sgrnas Cas9n Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 317 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sgrnas cas9n vector/product/Addgene inc
    Average 96 stars, based on 317 article reviews
    sgrnas cas9n vector - by Bioz Stars, 2026-03
    96/100 stars

    Images



    Similar Products

    sgrnas cas9n vector  (Addgene inc)
    96
    Addgene inc sgrnas cas9n vector
    Sgrnas Cas9n Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sgrnas cas9n vector/product/Addgene inc
    Average 96 stars, based on 1 article reviews
    sgrnas cas9n vector - by Bioz Stars, 2026-03
    96/100 stars
    		  Buy from Supplier
    px462 cas9n vector  (Addgene inc)
    94
    Addgene inc px462 cas9n vector
    Px462 Cas9n Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/px462 cas9n vector/product/Addgene inc
    Average 94 stars, based on 1 article reviews
    px462 cas9n vector - by Bioz Stars, 2026-03
    94/100 stars
    		  Buy from Supplier
    cas9n  (Addgene inc)
    93
    Addgene inc cas9n
    Cas9n, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cas9n/product/Addgene inc
    Average 93 stars, based on 1 article reviews
    cas9n - by Bioz Stars, 2026-03
    93/100 stars
    		  Buy from Supplier
    pmgc-cas9n plasmid  (NCIMB Ltd)
    90
    NCIMB Ltd pmgc-cas9n plasmid
    Pmgc Cas9n Plasmid, supplied by NCIMB Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pmgc-cas9n plasmid/product/NCIMB Ltd
    Average 90 stars, based on 1 article reviews
    pmgc-cas9n plasmid - by Bioz Stars, 2026-03
    90/100 stars
    		  Buy from Supplier
    pmgc-cas9n  (NCIMB Ltd)
    90
    NCIMB Ltd pmgc-cas9n
    Pmgc Cas9n, supplied by NCIMB Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pmgc-cas9n/product/NCIMB Ltd
    Average 90 stars, based on 1 article reviews
    pmgc-cas9n - by Bioz Stars, 2026-03
    90/100 stars
    		  Buy from Supplier
    px461 cas9n trp53 sgrna alpha plasmid  (Addgene inc)
    93
    Addgene inc px461 cas9n trp53 sgrna alpha plasmid
    Recipe for the Tp53 CRISPR and GFP reaction mixtures used for electroporation
    Px461 Cas9n Trp53 Sgrna Alpha Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/px461 cas9n trp53 sgrna alpha plasmid/product/Addgene inc
    Average 93 stars, based on 1 article reviews
    px461 cas9n trp53 sgrna alpha plasmid - by Bioz Stars, 2026-03
    93/100 stars
    		  Buy from Supplier
    px461 cas9n trp53 sgrna beta plasmid  (Addgene inc)
    93
    Addgene inc px461 cas9n trp53 sgrna beta plasmid
    Recipe for the Tp53 CRISPR and GFP reaction mixtures used for electroporation
    Px461 Cas9n Trp53 Sgrna Beta Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/px461 cas9n trp53 sgrna beta plasmid/product/Addgene inc
    Average 93 stars, based on 1 article reviews
    px461 cas9n trp53 sgrna beta plasmid - by Bioz Stars, 2026-03
    93/100 stars
    		  Buy from Supplier
    px335 encoding cas9n and chimeric single-guide (sg)rna  (Addgene inc)
    90
    Addgene inc px335 encoding cas9n and chimeric single-guide (sg)rna
    Recipe for the Tp53 CRISPR and GFP reaction mixtures used for electroporation
    Px335 Encoding Cas9n And Chimeric Single Guide (Sg)Rna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/px335 encoding cas9n and chimeric single-guide (sg)rna/product/Addgene inc
    Average 90 stars, based on 1 article reviews
    px335 encoding cas9n and chimeric single-guide (sg)rna - by Bioz Stars, 2026-03
    90/100 stars
    		  Buy from Supplier
    trp53 sgrna cctcgagctccctctgagcc  (Addgene inc)
    93
    Addgene inc trp53 sgrna cctcgagctccctctgagcc
    Recipe for the Tp53 CRISPR and GFP reaction mixtures used for electroporation
    Trp53 Sgrna Cctcgagctccctctgagcc, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/trp53 sgrna cctcgagctccctctgagcc/product/Addgene inc
    Average 93 stars, based on 1 article reviews
    trp53 sgrna cctcgagctccctctgagcc - by Bioz Stars, 2026-03
    93/100 stars
    		  Buy from Supplier

    Image Search Results


    Recipe for the Tp53 CRISPR and GFP reaction mixtures used for electroporation

    Journal: Bio-protocol

    Article Title: An Efficient Method for Immortalizing Mouse Embryonic Fibroblasts by CRISPR-mediated Deletion of the Tp53 Gene

    doi: 10.21769/BioProtoc.5159

    Figure Lengend Snippet: Recipe for the Tp53 CRISPR and GFP reaction mixtures used for electroporation

    Article Snippet: Px461-Cas9n-Trp53-sgRNA-alpha plasmid (Addgene, plasmid number: 88846; generated and deposited by the Massagué lab) [13] 14.

    Techniques: CRISPR, Suspension, Transfection

    Recipe for the Tp53 CRISPR and GFP reaction mixtures used for electroporation

    Journal: Bio-protocol

    Article Title: An Efficient Method for Immortalizing Mouse Embryonic Fibroblasts by CRISPR-mediated Deletion of the Tp53 Gene

    doi: 10.21769/BioProtoc.5159

    Figure Lengend Snippet: Recipe for the Tp53 CRISPR and GFP reaction mixtures used for electroporation

    Article Snippet: Px461-Cas9n-Trp53-sgRNA-beta plasmid (Addgene, plasmid number: 88847; generated and deposited by the Massague lab) [13] 15. pCAG-GFP plasmid (Addgene, plasmid number: 11150; generated and deposited by the Cepko lab) [14] Solutions 1.

    Techniques: CRISPR, Suspension, Transfection